Sequence ID | >W1610163573 |
Genome ID | FAOZ01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Parafrankia irregularis DSM 45899 [FAOZ] |
Start position on genome | 115421 |
End posion on genome | 115347 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaggcgccga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
tagtataatt |
Secondary structure (Cloverleaf model) | >W1610163573 Met CAT a ACtt tagtataatt C T G - C C - G G - C G - C G - C G - C T A T T G T C C A C G A G | | | | | A T C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |