Sequence ID | >W1610164565 |
Genome ID | FAVD01000008 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter hyointestinalis subsp. fetus [FAVD] |
Start position on genome | 10631 |
End posion on genome | 10707 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caattcaagt |
tRNA gene sequence |
GGGTTCATAGCTCAGTTGGTTAGAGCATCCGGCTCATAACCGGATGGTCCCAGGTTCGAG |
Downstream region at tRNA end position |
ctgcgtaatt |
Secondary structure (Cloverleaf model) | >W1610164565 Met CAT t ACCA ctgcgtaatt G - C G - C G - C T - A T - A C - G A - T T G T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T T A A TGGTC T - A C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |