| Sequence ID | >W1610169641 |
| Genome ID | FBBZ01000005 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [FBBZ] |
| Start position on genome | 85164 |
| End posion on genome | 85240 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
accccactaa |
| tRNA gene sequence |
GCGTTCGTAGCTCAACTGGATAGAGCAACAGACTTCGGATCTGTAGGTTATGGGTTCAAT |
| Downstream region at tRNA end position |
ccaaattttt |
| Secondary structure (Cloverleaf model) | >W1610169641 Arg TCG
a ACCA ccaaattttt
G - C
C - G
G - C
T + G
T + G
C - G
G - C T T
T T A T C C A
C A A A | | + | | A
T C T C G A T G G G C
G | | | | T T
G G A G C
A T A A AGGTT
A - T
C - G
A - T
G - C
A - T
C A
T G
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |