| Sequence ID | >W1610175247 | 
| Genome ID | FBHM01000014 | 
| Phylum/Class | Campylobacterota | 
| Species | Campylobacter coli [FBHM] | 
| Start position on genome | 35718 | 
| End posion on genome | 35792 | 
| Amino Acid | Thr | 
| Anticodon | GGT | 
| Upstream region at tRNA start position | ttttctgagc | 
| tRNA gene sequence | GCTCGTATGGCTCAGAGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGCGGGTTCAATTC | 
| Downstream region at tRNA end position | taaaattgaa | 
| Secondary structure (Cloverleaf model) | >W1610175247	Thr	GGT
                   c      TCCA taaaattgaa
                     G - C
                     C - G
                     T - A
                     C - G
                     G + T
                     T - A
                     A - T          T T
                    T     C G C C C     A
        G A        G      | | | | |     A
      A     C T C G       G C G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTC
                    C - G
                    T - A
                    C - G
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
 | 
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] | 
| Comment | |
| --- | |
| Input Comment |