Sequence ID | >W1610180633 |
Genome ID | FBMV01000005 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter coli [FBMV] |
Start position on genome | 72679 |
End posion on genome | 72772 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
ttataacttt |
tRNA gene sequence |
GGAAGATTAGCGTATCTGGTGATCGTCACTGACTTCAAATCAGATGAAAGGGTAGTTGAC |
Downstream region at tRNA end position |
gtaaaattta |
Secondary structure (Cloverleaf model) | >W1610180633 SeC TCA t Cgcc gtaaaattta G + T G - C A - T A - T G - C A - T T - A T T T C T C T C A C T A A | + | | | G T T G C G G G G A G C G | | + T T G T C G T T G A C TGAAAGGGTAGTTGACTATTCTTTG A A C - G T - A G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |