Sequence ID | >W1610193436 |
Genome ID | FCGU01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Serratia marcescens [FCGU] |
Start position on genome | 1007185 |
End posion on genome | 1007272 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgtcgttgc |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGCTGAAGGCAACGGTCTTGAAAACCGTCGACGGGAAACCGTTC |
Downstream region at tRNA end position |
tacattctga |
Secondary structure (Cloverleaf model) | >W1610193436 Ser TGA c GCCA tacattctga G - C G - C A - T G - C G - C G + T G - C T A T G T C T C A T G A G | | | | | G G G C C G C A G A G C G | | | T T C A G G C T G A A CGACGGGAAACCGTTC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |