Sequence ID | >W121034499 |
Genome ID | AHKQ01000026 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Myroides odoratus DSM 2801 [AHKQ] |
Start position on genome | 301936 |
End posion on genome | 301860 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caatttgact |
tRNA gene sequence |
GGTCCTATAACTCAGCTGGTTAGAGTAGCTGACTCATAATCAGCAAGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
caaaaaagca |
Secondary structure (Cloverleaf model) | >W121034499 Met CAT t ACAA caaaaaagca G - C G - C T - A C - G C - G T + G A - T C G T G G A C C A C G A A | | | | | G T C T C A C C T G G C G | | | | T T G G A G T T T A A AAGTC G - C C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |