Sequence ID | >WENV070730 |
Genome ID | AACY023820322 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 775 |
End posion on genome | 698 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gaccactttT |
tRNA gene sequence |
GGGGACTTAGCTCAGTTGGTAGAGCACCTGCTTTGCAAGCAGGGGGTCAGGGGTTCGAAC |
Downstream region at tRNA end position |
Aaccctccct |
Secondary structure (Cloverleaf model) | >WENV070730 Ala TGC T ACGG Aaccctccct G - C G - C G + T G - C A - T C - G T - A C A T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |