Sequence ID | >C131004330 |
Genome ID | CP003558 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Synechococcus sp. PCC 6312 [CP003558] |
Start position on genome | 952196 |
End posion on genome | 952122 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
taggcaaccT |
tRNA gene sequence |
GCGTCCTTAGTTCAGTTGGTAGAACGTCGGTCTCCAAAACCGGATGTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
atttttcaaa |
Secondary structure (Cloverleaf model) | >C131004330 Trp CCA T GTtg atttttcaaa G - C C - G G - C T + G C - G C - G T - A T G T C C T C C A T G A A | | + | | A T C T T G G G G G G C G | | | | T T G G A A C T A G ATGTC T + G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |