Sequence ID | >C131007546 |
Genome ID | CP003835 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Candidatus Portiera aleyrodidarum BT-QVLC [CP003835] |
Start position on genome | 306575 |
End posion on genome | 306648 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atgttactaT |
tRNA gene sequence |
GGGTCGTTAGCTCAGTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
atattcataa |
Secondary structure (Cloverleaf model) | >C131007546 Lys TTT T ATtt atattcataa G - C G - C G - C T - A C - G G - C T - A T A T C A T C C A G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |