Sequence ID | >W1610421398 |
Genome ID | FJBE01000005 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [FJBE] |
Start position on genome | 563 |
End posion on genome | 638 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tgatatgaaa |
tRNA gene sequence |
GCCCACATAGCTCAGGCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGTTGGTTCGAGT |
Downstream region at tRNA end position |
tgtaatataa |
Secondary structure (Cloverleaf model) | >W1610421398 Thr GGT a ACCA tgtaatataa G - C C - G C - G C - G A - T C - G A - T T G T T G A C C A G G A A + + | | | G C C T C G G T T G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |