| Sequence ID | >W1610425022 |
| Genome ID | FJEO01000005 |
| Phylum/Class | Gammaproteobacteria |
| Species | Legionella pneumophila [FJEO] |
| Start position on genome | 234593 |
| End posion on genome | 234518 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
aaagtactag |
| tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACATCGCCCTTTCACGGCGGTAACGGGGGTTCGAAT |
| Downstream region at tRNA end position |
ttatttggca |
| Secondary structure (Cloverleaf model) | >W1610425022 Glu TTC
g GCCA ttatttggca
G - C
T - A
C - G
C - G
C - G
C - G
A - T T A
T C C C C C A
A G A C | | | | | G
G T C T G G G G G G C
G + | | | T T
C G G A C
C T A A TAAC
T + G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |