Sequence ID | >W1610425596 |
Genome ID | FJFC01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [FJFC] |
Start position on genome | 172381 |
End posion on genome | 172305 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
taaagtcaaa |
tRNA gene sequence |
GTCCCGGTGGCACAGATGGATAGCGCAGCCCCCTCCTAAGGGGCAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
tttattaaag |
Secondary structure (Cloverleaf model) | >W1610425596 Arg CCT a GCCA tttattaaag G - C T - A C - G C - G C - G G - C G - C T A T C G T C C A A G A G | | | | | G T C A C G G C A G G C G | | | T T G G C G C A T A A AGGTC G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |