Sequence ID | >W1610428538 |
Genome ID | FJHU01000026 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [FJHU] |
Start position on genome | 567 |
End posion on genome | 492 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaagaatat |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGGGTTCGATT |
Downstream region at tRNA end position |
tctaaatagg |
Secondary structure (Cloverleaf model) | >W1610428538 Thr TGT t ACCA tctaaatagg G - C C - G T - A G - C G - C C - G G + T T T T G G T C C A T G A A | | + | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |