Sequence ID | >W1610429139 |
Genome ID | FJIJ01000019 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [FJIJ] |
Start position on genome | 8219 |
End posion on genome | 8294 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaagtactag |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACATCGCCCTTTCACGGCGGTAACGGGGGTTCGAAT |
Downstream region at tRNA end position |
ttatttggca |
Secondary structure (Cloverleaf model) | >W1610429139 Glu TTC g GCCA ttatttggca G - C T - A C - G C - G C - G C - G A - T T A T C C C C C A A G A C | | | | | G G T C T G G G G G G C G + | | | T T C G G A C C T A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |