Sequence ID | >W1610430438 |
Genome ID | FJJO01000040 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [FJJO] |
Start position on genome | 28005 |
End posion on genome | 28081 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gacctcttgt |
tRNA gene sequence |
GGCTATGTAGCTCAGCCGGTTAGAGCGCGGCACTCATAATGCTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
tttacatcat |
Secondary structure (Cloverleaf model) | >W1610430438 Met CAT t ACCA tttacatcat G - C G - C C - G T - A A - T T - A G - C T G T C C A C C A C G A A | | | | | G C C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G G + T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |