Sequence ID | >W1610434221 |
Genome ID | FJNA01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Trichococcus collinsii [FJNA] |
Start position on genome | 888938 |
End posion on genome | 888868 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acagcatttc |
tRNA gene sequence |
GGCGGTATAGCCAAGTGGTAAGGCACAGGTCTGCAAAACCTCTATCACCGGTTCAAATCC |
Downstream region at tRNA end position |
cacaagtaag |
Secondary structure (Cloverleaf model) | >W1610434221 Cys GCA c Tttc cacaagtaag G - C G - C C - G G - C G - C T - A A - T T A T T G G C C A G A A | | | | | A T A C C G A C C G G C G | | | T T G A G G C T A A TATC C C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |