Sequence ID | >C131003669 |
Genome ID | CP003466 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alloalcanivorax dieselolei B5 [CP003466] |
Start position on genome | 4221662 |
End posion on genome | 4221587 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctcgcttcat |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCCGGTCGGGGGTTCGACT |
Downstream region at tRNA end position |
ccttttctgc |
Secondary structure (Cloverleaf model) | >C131003669 Thr TGT t TCCA ccttttctgc G - C C - G T - A G - C G - C C - G G - C T C T T C T C C A T G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |