Sequence ID | >C131007669 |
Genome ID | CP003837 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Paraglaciecola psychrophila 170 [CP003837] |
Start position on genome | 4699838 |
End posion on genome | 4699762 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tatgagtttt |
tRNA gene sequence |
AGGGGTGTAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGATGGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
ctttattggc |
Secondary structure (Cloverleaf model) | >C131007669 Trp CCA t GCCA ctttattggc A - T G - C G - C G - C G - C T - A G - C T A T C T C C C A A A C A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A TGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |