Sequence ID | >C131003904 |
Genome ID | CP003495 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Cyanobium gracile PCC 6307 [CP003495] |
Start position on genome | 1595457 |
End posion on genome | 1595528 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aagggcccat |
tRNA gene sequence |
GCCGGCTTAGCTCAGTGGTAGAGCAGCGCTTTTGTAAAGCGAAGGCCATCGGTTCAAATC |
Downstream region at tRNA end position |
cagggatggg |
Secondary structure (Cloverleaf model) | >C131003904 Thr TGT t Ttgc cagggatggg G - C C - G C - G G - C G - C C - G T - A T A T T T G C C A G A A | | | | A T C T C G A T C G G C G | | | | T T G G A G C T A A AGGCC G A C - G G - C C - G T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |