Sequence ID | >C131012563 |
Genome ID | CP004079 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi DCMB5 [CP004079] |
Start position on genome | 815319 |
End posion on genome | 815244 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gtctgtttgt |
tRNA gene sequence |
GGGCCGTTAGCTCAGCTGGTAGAGCATCTGACTTTTAATCAGAGGGTCGTGGGTTCGAAC |
Downstream region at tRNA end position |
cttactcctt |
Secondary structure (Cloverleaf model) | >C131012563 Lys TTT t ACCA cttactcctt G - C G + T G - C C - G C - G G - C T - A C A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |