Sequence ID | >WENV072495 |
Genome ID | AACY023886984 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 1141 |
End posion on genome | 1065 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aatggggtaa |
tRNA gene sequence |
CGGGCTGTGGCGCAGCTTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
cgcaaacccc |
Secondary structure (Cloverleaf model) | >WENV072495 Pro GGG a ACCA cgcaaacccc C - G G - C G - C G - C C - G T - A G - C T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |