Sequence ID | >C131003013 |
Genome ID | CP003325 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium asteroides PRL2011 [CP003325] |
Start position on genome | 1213990 |
End posion on genome | 1214064 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttatgagcgc |
tRNA gene sequence |
CGGGCTATAGCGCAGCTTGGTAGCGCGCCTGCTTTGGGTGCAGGATGTCGCCGGTTCAAA |
Downstream region at tRNA end position |
ttgccttcgt |
Secondary structure (Cloverleaf model) | >C131003013 Pro TGG c ACtt ttgccttcgt C - G G - C G - C G - C C - G T - A A - T T A T C G G C C A C G A A | | | | | A T C G C G G C C G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |