Sequence ID | >W1610514748 |
Genome ID | FMAN01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactobacillus apis [FMAN] |
Start position on genome | 793960 |
End posion on genome | 793887 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cccgcttttg |
tRNA gene sequence |
GGGCCTATAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGATGGTTCAAG |
Downstream region at tRNA end position |
taaaataatg |
Secondary structure (Cloverleaf model) | >W1610514748 Ile GAT g Ataa taaaataatg G - C G - C G - C C - G C - G T - A A - T T G T T T A C C A C G A A + | | | | A T C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |