| Sequence ID | >W1610516486 |
| Genome ID | JAJH01000012 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli CVM 41970 [JAJH] |
| Start position on genome | 25950 |
| End posion on genome | 26035 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
tttcatttat |
| tRNA gene sequence |
GGTGAGTTACTCAAGTGGCCAACGAGGGCAGACTGTAAATCTGCTGGCTTTCGCCTTCCG |
| Downstream region at tRNA end position |
tgctttgcgg |
| Secondary structure (Cloverleaf model) | >W1610516486 Tyr GTA
t ACCA tgctttgcgg
G - C
G - C
T - A
G - C
A - T
G - C
T - A T A
T G C A C C A
T G A A | | | | | G
G A C T C C G T G G C
G | | | T T
C C G A G
C A A G TGGCTTTCGCCTTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |