Sequence ID | >W1610519072 |
Genome ID | JDTW01000015 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium gallicum DSM 20093 = LMG 11596 [JDTW] |
Start position on genome | 70699 |
End posion on genome | 70626 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
caacgaagat |
tRNA gene sequence |
GCCTCCATCGTCTAGCGGTCTAGGACTACGCCCTCTCACGGCGCCAACACCGGTTCAAAT |
Downstream region at tRNA end position |
gttcaccaca |
Secondary structure (Cloverleaf model) | >W1610519072 Glu CTC t ACtc gttcaccaca G + T C - G C - G T - A C - G C - G A - T T A T T G G C C A C G A C | | | | | A G T C T G A C C G G C G + | | | T T T G G A C C T A T CAAC A C C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |