Sequence ID | >W1610520242 |
Genome ID | JDUW01000006 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium reuteri DSM 23975 [JDUW] |
Start position on genome | 37021 |
End posion on genome | 36946 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tatgccaatc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGCTAGCGCACTTCGTTCACACCGAAGGGGTCGTAGGTTCGATT |
Downstream region at tRNA end position |
gatgcatccc |
Secondary structure (Cloverleaf model) | >W1610520242 Val CAC c ACCC gatgcatccc G - C G - C G - C C - G G - C A - T T - A T T T C A T C C A C G A G | | | | | G G C G C G G T A G G C G | | | | T T C G C G C T A A GGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |