Sequence ID | >W1610520425 |
Genome ID | JELY01001013 |
Search identical group | |
Phylum/Class | Myxococcota |
Species | Sorangium cellulosum [JELY] |
Start position on genome | 945 |
End posion on genome | 871 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gacagaacaa |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTAGGACATCGGCCTCTCACGCCGGTAACGCGGGTTCGATTC |
Downstream region at tRNA end position |
ctctctcctt |
Secondary structure (Cloverleaf model) | >W1610520425 Glu CTC a GCCA ctctctcctt G - C G + T T - A C - G C - G C - G A - T T T T C G C C C A C G A C | | | | | G G T C T G G C G G G C G + | | | T T T G G A C T A A TAAC T + G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |