Sequence ID | >W1610520729 |
Genome ID | JEME01001212 |
Search identical group | |
Phylum/Class | Myxococcota |
Species | Sorangium cellulosum [JEME] |
Start position on genome | 244 |
End posion on genome | 319 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cagcgattct |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCAGCGGATTCCAAATCCGCAGGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
gggaatgcgg |
Secondary structure (Cloverleaf model) | >W1610520729 Trp CCA t GCCG gggaatgcgg A - T G - C G - C G - C G - C T + G A - T C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTC G - C C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |