Sequence ID | >W1610521013 |
Genome ID | JGVX01000006 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi [JGVX] |
Start position on genome | 570450 |
End posion on genome | 570377 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ctttaaacgt |
tRNA gene sequence |
GGGCCGATAGCTCAATTGGCAGAGCAATTGACTCTTAATCAATTGGTTGGAGGTTCGAGT |
Downstream region at tRNA end position |
tatcacgttt |
Secondary structure (Cloverleaf model) | >W1610521013 Lys CTT t ACtt tatcacgttt G - C G + T G - C C - G C - G G - C A - T T G T C C T C C A T A A A | | | | | G T C T C G G G A G G C G | | | | T T G G A G C C A A TGGTT A - T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |