| Sequence ID | >W1610525107 |
| Genome ID | JOVC01000009 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli [JOVC] |
| Start position on genome | 36857 |
| End posion on genome | 36932 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
cttatgccct |
| tRNA gene sequence |
AGGGCAATAGCTCCAACGGTAGAGCACCGGATTCCAAATCCGATGGTTGGGGGTTCGAAT |
| Downstream region at tRNA end position |
taattaaggt |
| Secondary structure (Cloverleaf model) | >W1610525107 Trp CCA
t GCCA taattaaggt
A - T
G - C
G - C
G - C
C - G
A - T
A - T T A
T C T C C C A
A A C A | + | | | G
C C T C G G G G G G C
G | | | | T T
G G A G C
T A A TGGTT
C A
C - G
G - C
G - C
A - T
T A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |