Sequence ID | >W1610526815 |
Genome ID | JPUE01000005 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Nitrosopumilus sp. PRT-SC01 [JPUE] |
Start position on genome | 26806 |
End posion on genome | 26730 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caaacgtgtt |
tRNA gene sequence |
GCCGCCCTAGCTCAGCGTGGTAGAGCGTCCGACTGTTAATCGGATGGTCGTCAGTTCAAG |
Downstream region at tRNA end position |
cttgtttcta |
Secondary structure (Cloverleaf model) | >W1610526815 Asn GTT t GCCA cttgtttcta G - C C - G C - G G - C C - G C - G C - G T G T T A G T C A C G A A + | | | | A G C T C G G T C A G C T | | | | T T G G A G C G T A G TGGTC T - A C - G C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |