Sequence ID | >W1610540338 |
Genome ID | JSFG01000011 |
Search identical group | |
Phylum/Class | Thermotogota |
Species | Thermotoga sp. TBGT1765 [JSFG] |
Start position on genome | 90518 |
End posion on genome | 90430 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gtaaggacgc |
tRNA gene sequence |
GGAGGCGTGTCCGAACTGGCTAAGGAGCCGGTCTCGAAAACCGGTGGGCCGTGAGGCCCT |
Downstream region at tRNA end position |
ttttttgtat |
Secondary structure (Cloverleaf model) | >W1610540338 Ser CGA c GCCA ttttttgtat G - C G - C A - T G - C G - C C - G G - C T G T C A C C C A C A A G | | | | | G T G C C T G T G G G C G | | | T T G A G G A C T A G TGGGCCGTGAGGCCCTT C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |