Sequence ID | >W1610540369 |
Genome ID | JSFH01000004 |
Search identical group | |
Phylum/Class | Thermotogota |
Species | Thermotoga sp. Mc24 [JSFH] |
Start position on genome | 150051 |
End posion on genome | 149975 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aaaaatggat |
tRNA gene sequence |
CGGGGCGTAGCGCAGGTGGCTAGCGCGCCTGCCTTGGGAGCAGGAGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
tttttttatc |
Secondary structure (Cloverleaf model) | >W1610540369 Pro TGG t ACCA tttttttatc C - G G - C G - C G - C G - C C - G G - C T G T T G A C C A G G A A + | | | | A T C G C G G C T G G C G | | | | T T G G C G C C T A G AGGTC C - G C - G T - A G - C C - G C A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |