Sequence ID | >W1610545259 |
Genome ID | JTJQ01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Gallibacterium genomosp. 1 [JTJQ] |
Start position on genome | 26135 |
End posion on genome | 26211 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
caatataaat |
tRNA gene sequence |
CGGCGAGTAGCGCAGTTTGGTAGCGCAACTGGTTTGGGACCAGTGGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ttttttgttc |
Secondary structure (Cloverleaf model) | >W1610545259 Pro TGG t ACCA ttttttgttc C - G G - C G - C C - G G - C A - T G - C T A T T A T C C A T G A A + | | | | A T C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC A - T C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |