Sequence ID | >W1610576213 |
Genome ID | LAPS01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Citromicrobium sp. WPS32 [LAPS] |
Start position on genome | 26590 |
End posion on genome | 26514 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcccaccggc |
tRNA gene sequence |
GCGCCCGTAGCTCAGTCGGATAGAGCATCAGATTCCTAATCTGGGGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
gttcctcttt |
Secondary structure (Cloverleaf model) | >W1610576213 Arg CCT c GCCA gttcctcttt G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A T G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C A T A A GGGCC T + G C - G A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |