Sequence ID | >W1610578831 |
Genome ID | LAXZ01000005 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella pneumophila [LAXZ] |
Start position on genome | 76819 |
End posion on genome | 76903 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ataaaaataa |
tRNA gene sequence |
GCCGAAGTGGTGAAATTGGTAGACACGCCGTCTTGAGGGGGCGGTGGCGCAAGCCGTGCC |
Downstream region at tRNA end position |
ttttaaatcg |
Secondary structure (Cloverleaf model) | >W1610578831 Leu GAG a ACCA ttttaaatcg G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G G TGGCGCAAGCCGT C - G C - G G - C T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |