Sequence ID | >W1610584528 |
Genome ID | LCTF01000009 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Caldivirga sp. MU80 [LCTF] |
Start position on genome | 44238 |
End posion on genome | 44314 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cataggggtg |
tRNA gene sequence |
GGGCCCGTAGCTCAGCATGGTAGAGCGTCCGGCTCATAACCGGAAGGTCCCGGGTTCGAA |
Downstream region at tRNA end position |
gtgaacgtaa |
Secondary structure (Cloverleaf model) | >W1610584528 Met CAT g ACTA gtgaacgtaa G - C G - C G - C C - G C - G C - G G - C T A T G G C C C A C G A A | | | | | G A C T C G C C G G G C T | | | | T T G G A G C G T A G AGGTC T - A C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |