| Sequence ID | >W1610584538 |
| Genome ID | LCTF01000031 |
| Phylum/Class | Thermoproteota |
| Species | Caldivirga sp. MU80 [LCTF] |
| Start position on genome | 4916 |
| End posion on genome | 4839 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ttgttaatga |
| tRNA gene sequence |
GGGCCCGTAGCTTAGCCTGGTAAAAGCGCCCGGCTGATAACCGGGAGAACGTGGGTTCAA |
| Downstream region at tRNA end position |
atccatacat |
| Secondary structure (Cloverleaf model) | >W1610584538 Ile GAT
a ACTA atccatacat
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T C A C C C A
C C G A A | | | | | A
T T T C G G T G G G C
G | | | | T T
G A A G C
T A A G AGAAC
C - G
C - G
C - G
G - C
G - C
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |