| Sequence ID | >W1610590031 |
| Genome ID | LDRC01000025 |
| Phylum/Class | Actinomycetota |
| Species | Curtobacterium oceanosedimentum [LDRC] |
| Start position on genome | 68357 |
| End posion on genome | 68433 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ttggatgtgc |
| tRNA gene sequence |
CGCGGGGTGGAGCAGTTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCAAA |
| Downstream region at tRNA end position |
agcgtcacaa |
| Secondary structure (Cloverleaf model) | >W1610590031 Met CAT
c ACCA agcgtcacaa
C A
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
T G A G | + | | | A
T C G A G G T A G G C
C | | | | T T
G G C T C
G T A G AGGTC
C - G
T - A
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |