Sequence ID | >W1610593004 |
Genome ID | LDTE01000086 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas sanguinis [LDTE] |
Start position on genome | 43338 |
End posion on genome | 43265 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ccgccggttt |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGGAGCTTCCCAAGCTCACGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
tcaaaatctc |
Secondary structure (Cloverleaf model) | >W1610593004 Gly CCC t TCCA tcaaaatctc G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A CGAC G A G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |