Sequence ID | >W1610605182 |
Genome ID | LFRR01000078 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridiaceae bacterium DTU054 [LFRR] |
Start position on genome | 11415 |
End posion on genome | 11499 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caacaaatac |
tRNA gene sequence |
GGAGGGATACCCAAGAGGCCAAAGGGGGCAGACTGTAAATCTGTTGTCAGTGACTTCGAT |
Downstream region at tRNA end position |
gaaaatgcct |
Secondary structure (Cloverleaf model) | >W1610605182 Tyr GTA c ACCA gaaaatgcct G - C G - C A - T G - C G - C G - C A - T T A T C T A C C A A G A A | | | | | G G A C C C G A T G G C G | | | T T C A G G G C A A G TGTCAGTGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |