Sequence ID | >W1610612069 |
Genome ID | LGEK01000010 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Mucilaginibacter sp. L294 [LGEK] |
Start position on genome | 52861 |
End posion on genome | 52786 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tccaaacacg |
tRNA gene sequence |
GTAGATGTAGCTCAGTTGGTTAGAGCATCGGTTTGTGGTACCGAGGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
aacgcttctc |
Secondary structure (Cloverleaf model) | >W1610612069 His GTG g CCAg aacgcttctc G - C T - A A - T G + T A - T T - A G - C C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |