Sequence ID | >W1610612415 |
Genome ID | LGES01000037 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfobacterium sp. 37_54 [LGES] |
Start position on genome | 7975 |
End posion on genome | 7901 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctttaaggtg |
tRNA gene sequence |
GAGGCCGTAGCTCAATGGTAGAGCACCGGGCTGTGGCCCCGGGTGTTGCGGGTTCGAGTC |
Downstream region at tRNA end position |
ttttatgttt |
Secondary structure (Cloverleaf model) | >W1610612415 His GTG g CCCA ttttatgttt G - C A - T G - C G - C C - G C - G G - C T G T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GTGTT C - G C - G G - C G - C G - C C C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |