Sequence ID | >W1610612487 |
Genome ID | LGEU01000045 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobacteriaceae archaeon 41_258 [LGEU] |
Start position on genome | 6260 |
End posion on genome | 6176 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttagggatt |
tRNA gene sequence |
GCGGGGGTGCCCGAGCTGGCCAAAGGGGACAGGCTTAGGACCTGTTGGCGTAGGCCTACC |
Downstream region at tRNA end position |
tcaaaaaaag |
Secondary structure (Cloverleaf model) | >W1610612487 Leu TAG t ACtg tcaaaaaaag G - C C - G G - C G - C G - C G - C G - C T A T G T C C C A T C G A G | | | | | G G G C C C C A G G G C G | | | T T C A G G G C A A G TGGCGTAGGCCTAC A - T C - G A - T G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |