Sequence ID | >W1610613062 |
Genome ID | LGFK01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcinales archeaon 56_1174 [LGFK] |
Start position on genome | 16456 |
End posion on genome | 16381 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggatagcgtG |
tRNA gene sequence |
GCCGGGATAGGGTAGTGGTTATCCTTTGGCCCTGTGGAGGCTAAGACCCGAGTTCGAATC |
Downstream region at tRNA end position |
tctcgagggc |
Secondary structure (Cloverleaf model) | >W1610613062 His GTG G CTCA tctcgagggc G - C C - G C - G G - C G - C G - C A - T T A T G G C T C A T G A A | | | | | G G T G G G C C G A G C G | | + T T T T C C T T A T AGAC T - A G + T G - C C - G C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |