Sequence ID | >W1610613090 |
Genome ID | LGFK01000034 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcinales archeaon 56_1174 [LGFK] |
Start position on genome | 14686 |
End posion on genome | 14772 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcccttttgT |
tRNA gene sequence |
GCGGGGGTTGCCCAGCCAGGTCAAAGGCGCAAGGTTGAGGGCCTTGTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1610613090 Leu GAG T ACnn nnnnnnnnnn G - C C - G G - C G - C G - C G - C G - C T A T C A C T C A C C G A T | | | | | A A C C C G G T G A G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |