Sequence ID | >W1610613268 |
Genome ID | LGFP01000055 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfobacterium commune [LGFP] |
Start position on genome | 7576 |
End posion on genome | 7484 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
attaaaataa |
tRNA gene sequence |
GGAGGCGTGAGGAGGCTGGTGCCTCTCCCGGGCTTCAAACCCGGTGCGCCCCCAAAAGGG |
Downstream region at tRNA end position |
aagaaccttt |
Secondary structure (Cloverleaf model) | >W1610613268 SeC TCA a GCCA aagaaccttt G - C G - C A - T G - C G - C C - G G - C T - A T T G T A C C C A T C G A + | | | | A G G A G G G T G G G C G | | | + T T T C T C T G C C TGCGCCCCCAAAAGGGGTGG C - G C - G G - C G - C G - C C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |