Sequence ID | >W1610613384 |
Genome ID | LGFT01000080 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanothrix harundinacea [LGFT] |
Start position on genome | 86 |
End posion on genome | 1 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttcgattagc |
tRNA gene sequence |
GCGGGGGTAACCAAGCCAGGTCAACGGTGATAGACTCAAGATCTATTCTCGCAGGAGTTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1610613384 Leu CAA c ACnn nnnnnnnnnn G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A A | | | | | G A A C C A A A G G G C G | | | T T G C G G T T C A A G TCTCGCAGGAGTTC A - T T - A A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |