Sequence ID | >W1610623759 |
Genome ID | LHXN01000025 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | candidate division MSBL1 archaeon SCGC-AAA259E17 MSBL1 archaeon SCGC-AAA259E17 [LHXN] |
Start position on genome | 241 |
End posion on genome | 166 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
attgattgga |
tRNA gene sequence |
GGGCCCGTAGCTCAGTCGGCAGAGCGCCACCTTCGCAAGGTGGAAGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
tcccctctca |
Secondary structure (Cloverleaf model) | >W1610623759 Ala CGC a ACCA tcccctctca G - C G - C G + T C - G C - G C - G G - C T G T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C C A G AAGTC C - G C - G A - T C - G C - G T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |